Articles » Intermediate

Understanding genetics was so straightforward back in the good old days. I am not sure when those days were, but our picture of control systems in our bodies was easier when obvious stretches of DNA, called genes, were believed to control specific traits like eye colour and blood type. It used to be that we talked about genes and ‘junk DNA’. Now there are genes and there are control systems.  It was the use of supercomputers which changed our understanding of how the human genome works.

Many people are afraid of spiders, but they are excellent examples of God’s engineering design in nature, especially in the production and use of their silk.  Spider silk starts as a “liquid crystal”—a highly concentrated water-based solution containing rod-shaped molecules.  This means it both flows like a liquid and has its molecules oriented and ordered like a crystal.  The silk solution is produced and stored in a group of silk glands until it is drawn out through the silk ducts for use.  Evolutionists cannot decide whether the liquid crystal structure is an “accident of Nature” or a necessary requirement, but they think it may help to control crystallization.  If the silk crystallized prematurely, it would block the ducts and kill the spider. (De Luca & Rey) Creationists would call it a design feature.

On Tuesday, June 27, 2000 the National Post published a two page spread. At first glance, it did not look that exciting. The text on these pages consisted only of four letters, C, G, A and T, arranged in seemingly random order. The final line, for example, begins

CATGGTGTCATACTGCTCTTTATTTTATT… Read the rest of this entry »

Even the date was significant. On Monday, February 12 (the one hundred ninety-second anniversary of Charles Darwin’s birth), two groups of scientists released the results of their continuing studies into the human genome. This date was chosen since it is the understanding of most modern scientists, that details in the genetic code should give us spectacular insights into the process of evolution. But there were many surprises in the data. What did the results mean? Read the rest of this entry »

Biologists tell us that the ability to detect and identify odours is perhaps the most important sense that animals need to survive. By means of odour detection, insects locate food, avoid toxins and predators, and communicate with others of their own species. Their sense of smell is located mainly in their antennae.

One insect that is particularly talented in many respects, is none other than the famous fruit fly. For example, these red-eyed beauties exhibit extremely good abilities to find rotting fruit. Because fruit flies are easy to culture, biologists first studied odour detecting talents in these creatures. The study was expected to be interesting but scarcely earth-shattering. But guess what! Drosophila (fruit fly) was the tip of the iceberg to reveal that insects exhibit odour detecting abilities that are highly unusual and a major problem for evolutionary expectations. Since then similar studies have been conducted on moths, beetles, other flies, cockroaches and social insects. Read the rest of this entry »

Most people are at least somewhat interested in artifacts left behind by ancient civilizations. That is why tourists flock to the Mayan ruins in Mexico, or to Greece or Rome, or to Stonehenge in the south of England. Dr. Donald Chittick, a physical chemist, turned his attention to some traces of ancient civilizations and what these artifacts tell us about the people who produced them. His book The Puzzle of Ancient Man (third edition 2006) includes many interesting cases including a mechanism from ancient Greece that was in fact an analog computer. This is defined as “a device for calculating quantitative data by means of moving parts –“  (Jones 2017 p. 25). In keeping with Biblical revelation, it perfectly makes sense that the ancient peoples were very clever and inventive. But just how sophisticated was this early computer? Research conducted for more than a century, since this device was discovered in an ancient shipwreck in 1900,  demonstrates that the Antikythera Mechanism was astonishingly sophisticated. (See www.create.ab.ca/ancient-computer-astounds-everybody/#more-460 ) Read the rest of this entry »

The theme of Creation Weekend 2017 was “In Science and Faith, Worldview Matters”. Our speakers Carson Lueck and Dr. John Byl addressed this issue. Many people, in previous years, had indicated in questionnaires that they would be interested in presentations on apologetics. So here we were, considering worldviews. Naturally one might ask “What is a worldview? Why does it matter and how does it apply to our lives?” Read the rest of this entry »

Intelligent design, and indirectly the creation model, have been in the news a lot lately. Not surprisingly, most of the articles have been sympathetic, not to intelligent design, but to Darwinian evolution, the mechanistic explanation for life so favoured by the majority of scientists. Read the rest of this entry »

Recently scientists finished the detailed study of each human chromosome. The whole effort, begun in the 1980s, ended when the analysis of human chromosome number 1 was published on May 18, 2006. Since each of these strings of chemical code or genetic information is so different, allow me then to introduce you to some of your own chromosomes. Read the rest of this entry »

Among biologists, there have always been mavericks who dared to take a stand for the creation model. Point by point, these scientists have contested evolutionary speculation. But all too often such individuals have seemed like voices crying in the wilderness. The public often perceived creation based arguments as offering little but negativity. It is indeed the case that rearguard skirmishes won’t win a war. What is clearly needed, is a frontal assault on biological thinking. It is time to re-examine the foundations of biology. Thus it was in August 2001 that the Center for Origins Research and Education of Bryan College in Dayton, Tennessee; the Institute for Creation Research in El Cajon, California; and Cedarville University of Cedarville, Ohio — jointly sponsored a conference entitled “Discontinuity: Understanding Biology in the Light of Creation.” Read the rest of this entry »

Man of Vision:
Man of Action

Ivan was a true gentleman, a fine educator, a good friend and an active Christian. He knew “everybody” in education in Alberta and many in politics. Moreover, he and his wife Irene, took great pleasure in supporting many worthwhile endeavours. In their later years at their acreage, they grew flowers and food which they generously shared. If anybody needed help, they were there for them. Read the rest of this entry »

One of the most popular mammals is the lovable and cuddly koala. Its appearance has given rise to calling them bears, often teddy bears and, although they are not bears but rather marsupials, the name has stuck. Their fluffy ears, large spoon-shaped nose, round body and bright button eyes make them appealing to everyone. Read the rest of this entry »

The Creation Science Association of Alberta is delighted to announce that palaeontologist Kurt Wise has agreed to speak in Edmonton on the weekend of October 18, 2008. Few scientists anywhere can boast the depth of experience of Dr. Wise. Read the rest of this entry »

Review by Margaret Helder

A just-retired forensic scientist, Dr. Mark Sandercock, has written an amazing book on scripture, science and current attitudes and customs in our modern society and how these compare to biblical revelation. The book is written for all interested Christians, but especially for those who may have doubts about six-day creation and need a little encouragement.

This work is divided into three sections. The first deals with Genesis 1-11. The second section deals with the evolution paradigm and how this does not compare favourably with what we see in nature, or indeed in scripture. The third section deals with several popular practices which plague our society, and why these customs are allowed and encouraged today when former generations did not allow anything of the kind.

One does not have to be a scientist with an advanced degree in physics or geology to appreciate the relevance of recent studies on the radiometric dating of rocks and biological materials. The book Thousands… not Billions and the DVD of the same name, are designed to communicate to the general public the results of recent research which fit a young age for the earth. Read the rest of this entry »