Articles » Intermediate
After watching the video Fearfully and Wonderfully Made, I couldn’t help exclaiming to my sister, husband, mother and anyone who would listen: “You have to watch this fascinating video!” Read the rest of this entry »
A lot of books include the term design in their titles. Some however are too technical and others are perhaps too basic for the interested adult reader. A recently published book by Jonathan Sarfati entitled By Design: Evidence for Nature’s Intelligent Designer – the God of the Bible (Creation Book Publishers. 2008) promises to provide a more user friendly introduction to the topic. Read the rest of this entry »
For many years, evolutionists have claimed that the bulk of the human genome is junk, debris left over from long periods of evolution. These people should rather have asked what was the function of these long stretches of non-coding DNA (about 97%). Recent research such as the Human Genome Project (HGP) has vindicated those who rejected the junk DNA idea and the insights keep on coming! Read the rest of this entry »
Although they may have been a little slow on their feet, it seems safe to say that horned dinosaurs represent a flamboyant and fun group to discuss. Read the rest of this entry »
HeadStart is a completely new tool available for high school students and their teachers (and postsecondary students). Written and developed by the Creation Science Association of Alberta, this tool is free and easily accessed. Check it out at www.create.ab.ca/headstart
Many people recognize that it is a privilege to learn about God, the Creator and his Creation. That is why, besides observing the natural environment in which we find ourselves, it is a pleasure to go beyond mere observations to discover how things work and why. Most young people undertake to study some science, at least at the high school level. But there is a problem, most programs of study include a lot of evolutionary concepts that point away from God and his work. Even seemingly innocent terms like microevolution, convergence, nucleus, fossil record and plant biology are loaded with evolutionary concepts. However, these phenomena themselves actually point overwhelmingly to the work of God, the Creator as described in Genesis and throughout the Bible. It was to communicate this message, that HeadStart was developed.
Read the rest of this entry »The media are full of accounts of how people have used their unexpected “down time” at home during the COVID pandemic. What we chose, be it bread baking or house-cleaning or crafts or whatever, obviously reflected personal preference. As far as I was concerned, this time was a golden opportunity to do some extra scientific reading. It all began with an article in Nature that promoted an ancestral relationship for red seaweeds with an organism that was the exact opposite of all the features in red seaweeds. Perhaps I lack imagination but I could not believe that this prestigious journal had indeed published such an argument. It seemed hilarious to me. Read the rest of this entry »
The objective of education, in general, is to equip upcoming generations to understand their place in society and how to contribute in a meaningful way to the well-being of that society. Christians go further. Each generation seeks to communicate with youngsters our relationship to God, and our relationship to people and the world in which we live. Christians therefore declare that an important part of our mandate as citizens and believers, is to make sure that we are informed about current events and issues such as science which can exert such a dramatic impact on society, especially today. Thus, we seek to acquiesce with, or speak out against, various important policies in government and society. Indeed, few issues today have fashioned the values of society as much as has scientific thinking and the philosophical implications thereof.
Read the rest of this entry »A myth, one might imagine, is a story or explanation that is widely believed, but has no basis in fact. While there were numerous myths in the past, modern man believes that he has no need for such fabrications. Science, after all, undertakes to explain everything, and it is empirical and objective, so the saying goes. But even in science, some myths do creep into the public consciousness. It is interesting to notice how popular misunderstandings of scientific information appear and are propagated. An example springs to mind. Consider the recent studies on the “age” of the human race, for example. The conclusions and some headlines were actually misleading. One wonders how many readers obtained an inaccurate understanding of the issue. Let us investigate that case. Read the rest of this entry »
Many people are afraid of spiders, but they are excellent examples of God’s engineering design in nature, especially in the production and use of their silk. Spider silk starts as a “liquid crystal”—a highly concentrated water-based solution containing rod-shaped molecules. This means it both flows like a liquid and has its molecules oriented and ordered like a crystal. The silk solution is produced and stored in a group of silk glands until it is drawn out through the silk ducts for use. Evolutionists cannot decide whether the liquid crystal structure is an “accident of Nature” or a necessary requirement, but they think it may help to control crystallization. If the silk crystallized prematurely, it would block the ducts and kill the spider. (De Luca & Rey) Creationists would call it a design feature.
Read the rest of this entry »On Tuesday, June 27, 2000 the National Post published a two page spread. At first glance, it did not look that exciting. The text on these pages consisted only of four letters, C, G, A and T, arranged in seemingly random order. The final line, for example, begins
- CATGGTGTCATACTGCTCTTTATTTTATT… Read the rest of this entry »
Even the date was significant. On Monday, February 12 (the one hundred ninety-second anniversary of Charles Darwin’s birth), two groups of scientists released the results of their continuing studies into the human genome. This date was chosen since it is the understanding of most modern scientists, that details in the genetic code should give us spectacular insights into the process of evolution. But there were many surprises in the data. What did the results mean? Read the rest of this entry »
Biologists tell us that the ability to detect and identify odours is perhaps the most important sense that animals need to survive. By means of odour detection, insects locate food, avoid toxins and predators, and communicate with others of their own species. Their sense of smell is located mainly in their antennae.
One insect that is particularly talented in many respects, is none other than the famous fruit fly. For example, these red-eyed beauties exhibit extremely good abilities to find rotting fruit. Because fruit flies are easy to culture, biologists first studied odour detecting talents in these creatures. The study was expected to be interesting but scarcely earth-shattering. But guess what! Drosophila (fruit fly) was the tip of the iceberg to reveal that insects exhibit odour detecting abilities that are highly unusual and a major problem for evolutionary expectations. Since then similar studies have been conducted on moths, beetles, other flies, cockroaches and social insects. Read the rest of this entry »
Most people are at least somewhat interested in artifacts left behind by ancient civilizations. That is why tourists flock to the Mayan ruins in Mexico, or to Greece or Rome, or to Stonehenge in the south of England. Dr. Donald Chittick, a physical chemist, turned his attention to some traces of ancient civilizations and what these artifacts tell us about the people who produced them. His book The Puzzle of Ancient Man (third edition 2006) includes many interesting cases including a mechanism from ancient Greece that was in fact an analog computer. This is defined as “a device for calculating quantitative data by means of moving parts –“ (Jones 2017 p. 25). In keeping with Biblical revelation, it perfectly makes sense that the ancient peoples were very clever and inventive. But just how sophisticated was this early computer? Research conducted for more than a century, since this device was discovered in an ancient shipwreck in 1900, demonstrates that the Antikythera Mechanism was astonishingly sophisticated. (See www.create.ab.ca/ancient-computer-astounds-everybody/#more-460 ) Read the rest of this entry »
The theme of Creation Weekend 2017 was “In Science and Faith, Worldview Matters”. Our speakers Carson Lueck and Dr. John Byl addressed this issue. Many people, in previous years, had indicated in questionnaires that they would be interested in presentations on apologetics. So here we were, considering worldviews. Naturally one might ask “What is a worldview? Why does it matter and how does it apply to our lives?” Read the rest of this entry »
Intelligent design, and indirectly the creation model, have been in the news a lot lately. Not surprisingly, most of the articles have been sympathetic, not to intelligent design, but to Darwinian evolution, the mechanistic explanation for life so favoured by the majority of scientists. Read the rest of this entry »