Articles » Genetics
The experiment with fruit flies was basically uncomplicated. Any university student could have carried it out providing they could identify and count the various mutant forms. But there was more to the issue than mere counts of fruit fly offspring. The study was supposed to, and had long been considered that it in fact did, support a key idea of Charles Darwin. More than sixty years had passed since the fruit fly work was published. Subsequent to publication in the new journal Heredity in 1948, few people paid much attention to the study until it was quoted favourably in 1972 and 1994 as supporting Darwin’s idea of sexual selection. Those references conferred celebrity status on the work and many citations followed. But then in 2012 a study was published which questioned not only the 1948 work, but also a major component of Darwin’s theory of evolution. However the reasons and issues surrounding the new study are not what we might hope or expect. It is important to remember that scientists draw conclusions in keeping with their world view and there is more diversity in world views in science than one might imagine.
Sometimes it seems as if information is the most important commodity in our technological age. Information, of course, can be put to good or bad uses. We would all agree, no doubt, that computer viruses are a bad use of information. In that situation, a small piece of computer code (information), once it is inside your computer, can take over the whole operating system, with disastrous results for your interests. Of course such problems are nothing new. The term “virus” comes from natural phenomena that do the very same thing to living cells. Invading information occurs to even the smallest cells, bacteria. In fact, some of the bacteria that most threaten our health, are themselves the victims of invasive information from outside unrelated sources. Consider the case of the infamous Escherischia coli 0157:H7, cause of potentially fatal hamburger disease and in some isolated situations, contaminated water. Read the rest of this entry »
If bats were prettier to look at, we might appreciate their amazing talents more. The fact is that bats exhibit some astonishing design features which our engineers and technologists really envy. Traditionally scientists have grouped bats according to their food preferences. There are the fruit bats with good eyesight, the insect consuming, echolocating bats and the vampire or blood consuming bats. Further research has revealed how amazingly these animals are designed for their life styles. Such studies have also revealed that the old fashioned ways of categorizing the creatures according to lifestyle and physical appearance do not really work. This has had some serious implications for ideas concerning whether Darwinian evolution could ever work or not. Read the rest of this entry »
CSAA’s featured speaker for Creation Weekend 2011 was well known creation apologist Dr. Jerry Bergman. Large numbers of people came to hear one or more of his lectures and all declared themselves delighted with his genial, non-confrontational manner and his interesting material. In that Dr. Bergman’s area of expertise is biology, chemistry and medical anatomy, the issues he discussed were quite different from the geological topics which we have considered in recent years. This material demonstrated anew that the issue of creation is broad and encompasses all aspects of nature. Read the rest of this entry »
An avid fan of spy stories, I have read many which involve an apparently harmless document (like a friendly letter). But the document actually conveys dangerous information if one is provided with the appropriate convention for decoding it. Read the rest of this entry »
Recently scientists finished the detailed study of each human chromosome. The whole effort, begun in the 1980s, ended when the analysis of human chromosome number 1 was published on May 18, 2006. Since each of these strings of chemical code or genetic information is so different, allow me then to introduce you to some of your own chromosomes. Read the rest of this entry »
I really hate to admit it, but in certain situations I am old fashioned! In the good old days, biology students were taught about living organisms. We learned the appearance, life cycles and ecological preferences of various groups of plants, animals, fungi and microbes. Read the rest of this entry »
Scientists are continually discovering remarkable molecular machines which work inside each living cell. One such machine involves proofreading. Anytime you or I copy a document, it is always a good idea to proofread the script. Since each cell copies or duplicates its own genetic code or DNA before cell division, the cell would be well advised to check the new strands to make sure there are no copying errors. Read the rest of this entry »
The striking image on the cover of this book is a crystal of DNA. What more effective illustration could one imagine for a book which deals with the significance of biochemistry for our understanding of biology? Read the rest of this entry »
The big surprise in April 1953 was not that the structure, and by implication the function, of DNA had been discovered, but rather who had done it. With established scientists like American Linus Pauling of Caltech in Pasadena, and British scientists Maurice Wilkins and Rosalind Franklin at King’s College, University of London, carrying out such research, it was expected that the problem would soon be solved. These scientists all had research funds, experience and appropriate equipment. Read the rest of this entry »
In former generations, some misguided human biologists used to speculate that the various human races were in process of becoming increasingly different. This process, termed “divergence,” is an important component of evolution theory. The idea is that our world population is composed of more or less isolated groups or races of individuals who are quite similar to each other but significantly different from individuals of another race or ethnic background. Since the theory also, of course, includes the idea that our human population has been around at least one million or more years, it would then seem reasonable to assume that humanity had had lots of time to “diverge,” for the races to become more and more different from each other. Of course, if humans have only been around a short time, then racial differences might be merely superficial, more skin deep rather than significant and the human population might not really have “diverged” at all. Read the rest of this entry »
Many of us may not realize it yet, but in recent years there has been a dramatic shift in thinking about nature on the part of some cell biologists. Indeed even traditional biotechnology is nothing compared to these new frontiers. In the past, over the millennia, people have wondered about nature and increasingly have applied themselves to finding out how it worked. Once we had some insights, not surprisingly, attempts were made to manipulate nature for mankind’s benefit. Thus we have progressed beyond plant and animal breeding to the insertion of specific pieces of genetic information into target organisms. Some observers have questioned the ethics of these approaches, but the objectives were mainly practical, not philosophically driven. Read the rest of this entry »
Even the date was significant. On Monday, February 12 (the one hundred ninety-second anniversary of Charles Darwin’s birth), two groups of scientists released the results of their continuing studies into the human genome. This date was chosen since it is the understanding of most modern scientists, that details in the genetic code should give us spectacular insights into the process of evolution. But there were many surprises in the data. What did the results mean? Read the rest of this entry »
On Tuesday, June 27, 2000 the National Post published a two page spread. At first glance, it did not look that exciting. The text on these pages consisted only of four letters, C, G, A and T, arranged in seemingly random order. The final line, for example, begins
- CATGGTGTCATACTGCTCTTTATTTTATT… Read the rest of this entry »
Have you ever imagined yourself as a best selling author? Detective stories sell well. Let’s give it a try. My story is set in an imposing country home in England. The wealthy owner happens to wander into his wife’s dressing room. She is away on an expedition to the beach. The gentleman notices his wife’s diamond necklace carelessly flung onto the table amidst expensive perfume bottles. Horrified, he swoops down upon the jewelry, only to discover that this is a cheap imitation of the real necklace. Promptly he calls the local inspector who sends out four detectives. The detectives snoop around and each presents his theory on the case. Detective Smith declares that the butler stole the necklace and sold it in London. Detective Jones strongly suggests that his evidence implicates the maid. Detective Cooper accuses the daughter’s boyfriend of helping himself to the jewels. Detective Trent indicates that the evidence points to the son of the family who has wasted huge sums of money on fast cars. The gentleman is now thoroughly confused. When his wife returns home, he shares all these distressing details with her. It is then that his wife informs him that actually she lent the real necklace to her sister, Lady Hampton, who is scheduled to attend a royal court event that very evening. Read the rest of this entry »