Articles » Genetics
Many of us may not realize it yet, but in recent years there has been a dramatic shift in thinking about nature on the part of some cell biologists. Indeed even traditional biotechnology is nothing compared to these new frontiers. In the past, over the millennia, people have wondered about nature and increasingly have applied themselves to finding out how it worked. Once we had some insights, not surprisingly, attempts were made to manipulate nature for mankind’s benefit. Thus we have progressed beyond plant and animal breeding to the insertion of specific pieces of genetic information into target organisms. Some observers have questioned the ethics of these approaches, but the objectives were mainly practical, not philosophically driven. Read the rest of this entry »
Even the date was significant. On Monday, February 12 (the one hundred ninety-second anniversary of Charles Darwin’s birth), two groups of scientists released the results of their continuing studies into the human genome. This date was chosen since it is the understanding of most modern scientists, that details in the genetic code should give us spectacular insights into the process of evolution. But there were many surprises in the data. What did the results mean? Read the rest of this entry »
On Tuesday, June 27, 2000 the National Post published a two page spread. At first glance, it did not look that exciting. The text on these pages consisted only of four letters, C, G, A and T, arranged in seemingly random order. The final line, for example, begins
- CATGGTGTCATACTGCTCTTTATTTTATT… Read the rest of this entry »
Have you ever imagined yourself as a best selling author? Detective stories sell well. Let’s give it a try. My story is set in an imposing country home in England. The wealthy owner happens to wander into his wife’s dressing room. She is away on an expedition to the beach. The gentleman notices his wife’s diamond necklace carelessly flung onto the table amidst expensive perfume bottles. Horrified, he swoops down upon the jewelry, only to discover that this is a cheap imitation of the real necklace. Promptly he calls the local inspector who sends out four detectives. The detectives snoop around and each presents his theory on the case. Detective Smith declares that the butler stole the necklace and sold it in London. Detective Jones strongly suggests that his evidence implicates the maid. Detective Cooper accuses the daughter’s boyfriend of helping himself to the jewels. Detective Trent indicates that the evidence points to the son of the family who has wasted huge sums of money on fast cars. The gentleman is now thoroughly confused. When his wife returns home, he shares all these distressing details with her. It is then that his wife informs him that actually she lent the real necklace to her sister, Lady Hampton, who is scheduled to attend a royal court event that very evening. Read the rest of this entry »
A special section in the December 11, 1998 issue of the journal Science was devoted to a celebration of the roundworm Caenorabditis elegans. Although a lengthy name has been conferred on this creature, the organism itself is actually at most about 1 mm long. Of the 20,000 or so known species of roundworm or nematode, most are parasites. This species, however, (generally called by the more catchy title of C. elegans), lives free in the soil. Hardly visible to the naked eye, an individual worm nevertheless appears very large when viewed through an ordinary microscope. Except for cells destined to become eggs or sperm, this animal consists of only 959 cells. The whole creature is quite transparent so that, through the microscope, one can easily view the various cells and organs. Development of an individual is fast too, requiring only three days in a life span of two or three weeks. Such an organism seemed ideal for laboratory studies. Thus in 1963 Cambridge biologist Sydney Brenner began a research program which continues to the present. And what fascinating results have been obtained! Read the rest of this entry »
We all like to communicate, don’t we – at the very least to tell others what to do. Indeed a slang expression has been coined about this “Communication is the name of the game!” People, of course, are able to communicate in words. However there are other sorts of communication which do not involve words, but which nevertheless involve information. Some scientists, especially in their study of biology, have become very interested in information and its source. Dr. A. E. Wilder-Smith, for example, discussed the genesis of biological information in his 1981 book The Natural Sciences Know Nothing of Evolution. Moreover this fall two new books on this subject (by Dr. William A. Dembski) are scheduled to be released. Dr. Dembski is an associate editor of Origins and Design (www.arn.org) and the titles of these new books are The Design Inference (Cambridge) and Mere Creation: Reclaiming the Book of Nature (InterVarsity). Dr. Dembski’s interest in information theory is in its implications for origins theory. This also was Dr. Wilder-Smith’s concern. In addition there is another book recently translated from German, which provides fascinating insights on this topic. The title of Dr. Werner Gitt’s book is In the Beginning was Information. Read the rest of this entry »
History is full of sad stories. Nobody needs to tell us that. Nevertheless many tragic events have been obscured by the mists of time. It sometimes seems that we scarcely know or care any more about the crusades, European wars or treaties during the Middle Ages or events before or after that time. Eighty years ago however, the assassination of the Romanovs, the Russian czar and his family took place in the Siberian town of Yekaterinburg. The events were so shrouded in mystery, and the victims so interesting (particularly the four beautiful daughters), that public interest in the story has never faded. Now, thanks to some remarkable espionage carried out in Russia during the final years of the Communist regime, and to some recently developed skills in forensic science, the final chapter on the Romanov saga will be written during the summer of 1998. If all goes according to plan, the Romanovs will be buried in the family sepulchre in St. Peter and St. Paul Cathedral in St. Petersburg. The funeral service with appropriate imperial grandeur is scheduled for July 17 — 80 years to the day after their untimely deaths. Read the rest of this entry »
Evolutionists have long had a difficult time trying to account for the development of cells with nuclei. The first step, of course, is to agree on a suitable ancestor. The popular choice is bacteria (prokaryotes) which typically have only a single circular chromosome lying free in the cell. Unfortunately there are numerous structural and metabolic differences between the assumed ancestors and presumed descendants. Various theories have been proposed to explain how this new cell type might have developed, but none has proved extremely satisfactory. Thus the old theories tend to get recycled. An explanation is accepted for a while and later falls into disfavour as another old theory is retrieved from mothballs. The problem is that none of these theories fits the observed facts very well at all. Read the rest of this entry »
A myth, one might imagine, is a story or explanation that is widely believed, but has no basis in fact. While there were numerous myths in the past, modern man believes that he has no need for such fabrications. Science, after all, undertakes to explain everything, and it is empirical and objective, so the saying goes. But even in science, some myths do creep into the public consciousness. It is interesting to notice how popular misunderstandings of scientific information appear and are propagated. An example springs to mind. Consider the recent studies on the “age” of the human race, for example. The conclusions and some headlines were actually misleading. One wonders how many readers obtained an inaccurate understanding of the issue. Let us investigate that case. Read the rest of this entry »
Sometimes the good old days look so appealing. Wouldn’t it be nice to return to the optimistic and traditional 1950s, for example? Alternatively a nice isolated cottage in the woods somewhere would be fine. We could spend our days far from the terrors of technology and pure science. Obviously however, such visions are unrealistic. Christians were placed in this world to be the salt of the earth. There is no escape from the dilemmas of this life. Read the rest of this entry »