Featured in the newest Dialogue Magazine »

Human Genome: The Molecule is the Message

On Tuesday, June 27, 2000 the National Post published a two page spread. At first glance, it did not look that exciting. The text on these pages consisted only of four letters, C, G, A and T, arranged in seemingly random order. The final line, for example, begins

    CATGGTGTCATACTGCTCTTTATTTTATT…

A small note tells us why this newspaper devoted two pages (B6 and B7) to what appears like gibberish. Apparently the 32,767 letters on these pages are part of the sequence or order of information for human Chromosome 17. This piece of DNA (deoxyribonucleic acid) molecule is one of 23 different chromosomes that direct development and life functions of each person. The note also reveals that it would require 2606 double-page spreads of text to print the entire sequence of Chromosome 17 and 91,555 double page spreads to print the entire contents of all 23 chromosomes (a total of about 3 billion letters)!!

Many people were at first excited about so much new information. But further reflection somewhat muted this enthusiasm. The text has no breaks, no capitals or sentences that we can see. Does it mean anything? What good is all that text if we can’t decipher the meaning? Evidently the human fertilized egg is able to read the text as are the daughter cells that result from division of the initial single cell. Otherwise there would be no resulting individuals with typical human characteristics.

We are not however totally clueless about the messages contained in the DNA molecules (chromosomes). In 1989, molecular biologists in the United States (with international collaborators) began the monumental task of documenting every single chemical component of the human genetic code. The project was expected to take 15 years and to cost three billion dollars. The early strategy of the Human Genome Project (HGP) scientists was to identify interesting stretches of chromosome, usually a gene implicated in a disease. Small pieces of this piece of DNA molecule were farmed out to various laboratories for sequencing (identifying the order of the 4 letters A, T, C, and G). Later computers were used to establish how the fragments should be reconnected to obtain the original order again.

As the government sponsored HGP program approached the half way point of its 15 year mandate, only 3% of its objective had been achieved. At least however the scientists knew the approximate function of each gene studied (often involving about 150,000 letters). This sedate pace however would soon be shattered. Dr. Craig Venter was a scientist who had been refused grant money to describe the genetic information in the influenza bacterium. The funding agency said his approach would not work. The only catch was that by the time the letter arrived, Dr. Venter had already nearly completed the sequence and his approach did work.

Dr. Venter now turned his attention to the human genome project. He was not interested in working with specific genes. What he advocated was the sequencing of the whole genome. The locating of genes and identification of their function would come later. In May 1998 Dr. Venter and the equipment manufacturer Perkin-Elmer announced the formation of Celera Genomics Corporation. Perkin-Elmer would supply 300 robot machines capable of sequencing the DNA molecule at an incredible speed (1000 letters per second). Dr. Venter announced that they would sequence the whole human genome within three years. Scientists from the HGP laughed (nervously). Then they too changed their strategy. Celera’s robots began their work in September 1999. Within seven months the company claimed success. It soon became apparent however that the newcomer owed a considerable debt to information posted on the Internet from the government sponsored HGP. So both groups were accorded equal credit.

After the congratulations and the celebrations however, some people began to wonder what exactly we had achieved. An editorial in the National Post pointed out what should have been obvious: “If the genome is indeed ‘the book of life’ we know neither how it works nor how to harness its potential.” (June 27, 2000). The interesting thing is that everyone understands that the DNA molecule is a code that conveys information. We may not yet be able to read the code, but we know that it communicates the “how to” for each living cell. Some basics of the DNA message we have however discovered.

DNA consists of a string of identical sugar molecules, each linked together by a small acid ion (phosphate). Thus we start with a single chain of linked sugar molecules. Have you ever seen a charm bracelet with a single ornament suspended from each link of the chain? DNA is like that. To each sugar molecule, one of four available molecules is attached. The four possible molecules are identified by the letters A, T, C or G. It also so happens that A and T fit very nicely together and similarly C and G make a good pair. Thus if a second chain of sugars is lined up opposite the first one, opposite letters come to occupy the same level on the two chains. Opposite an A, we find a T. Opposite a G, we find a C and vice versa. As a result, when we have one molecule as a template or basic pattern, we can produce lots of identical ones by matching up opposing letters. A chain with the order AACCTTGG would generate TTGGAACC on the opposite chain, but that one would generate again AACCTTGG. So far however we have not progressed very far toward discerning a code.

Scientists have furthermore discovered information resides in the particular order of letters along a single chain. Triplets of letters (various combinations of three, of the four available letters) code for one or other of the twenty amino acids present in living cells. The cell strings together various combinations of amino acids to form the proteins that are so essential to its structure and life sustaining processes. Special components in the cell read off the order of triplets (3 letter codes). However it matters very much where the reading begins. For example, if we read the sequence ATGCCTAACGTC beginning at the letter A, then we would string together the amino acids methionine, proline, asparagine and valine. However, if we start one letter over, at the T, our triplets are all different and we string together the amino acids serine, leucine, threonine and serine. Obviously we will have a very different protein. Such factors mean that it will be very difficult to read the DNA sequences. We have moreover discovered that parts of the DNA molecule can be read in different orders to obtain different proteins. Some sequences of DNA can be read forward for one protein and backward for a different one. There is no question that DNA is a code that contains incredibly complicated information packaged in a fashion that is itself obscure to say the least.

Since we, with all our technology, have so little understanding of the information in the DNA molecule, the question arises as to who else might have the capacity to understand it? If we don’t, who does? Obviously the sender of the message, at least, must understand the code. Our experience and common sense tell us that a message comes from an intelligent sender. The search for extraterrestrial intelligence (SETI) is based on that understanding. Radio astronomers are listening for noises from space which might be in the form of a code and thus indicative of a message. Codes and messages do not develop spontaneously or on their own.

Mathematician Dr. William Dembski sums up the issue of the likelihood of messages being generated through natural processes: “But the basic idea that there is no better test for intelligence than coherent language communication remains intact ….. a being that solves problems beyond the computational resources of the material world is not material.” (in J. P. Moreland, ed. The Creation Hypothesis. IVP p. 127) In the case of DNA, it is obvious that it is a coded message. Since the originator of any code cannot be part of nature, the originator of this particular one must be supernatural. Design of the DNA code, after all, obviously preceded the creation of life on earth. In other words, God designed and sent the message hidden to this point in the lengthy coils of the DNA molecule. When we think of all the information in every genome, we can only worship the Creator.

Margaret Helder
October 2000

Subscribe to Dialogue