Level Legend
-
Children
-
Introductory
-
Intermediate
-
Technical
Archive for 2000
Check the Lobster Lips
Have you ever discovered something new, like a new recipe, a new and better way to carry out a task, or a new object in the sky? Whether you have invented a device which will make you rich, or whether you have identified a new phenomenon in nature, the joy of discovery is a reward in itself. When it comes to identifying new organisms, many people have turned their attention to the rain forest. New plants and new animals, often insects, are routinely described from that part of the world. Deep sea divers have also encountered some very strange creatures from the ocean depths. The sea between Denmark and Sweden, however has been fished for many centuries. We would not expect to find any new creatures in those cold waters, would we? Read the rest of this entry »
Flip Side of the Midnight Sun
An old song runs over and over through my head: “We’re off to Alaska, land of the midnight sun!” Indeed this attractive feature of the far north attracts scores of tourists. However like many situations, this one involves good news and bad news. The good news is the endless summer days. The bad news, of course, is the endless winter nights. All living creatures thrive in the north during the summer. Plants grow quickly and animals rise their young. The winter however is not only dark, but also very cold. How, one wonders, would organisms fare there if the climate were still dark, but not cold? That’s an interesting question because there is scientific evidence for such a situation in the past. Some of the evidence is Canadian and some is American. Read the rest of this entry »
Home Sweet Home
Several years ago I tried my hand at bird’s nest building. It wasn’t actually my idea to do this. As mother helper of the day, it was my job to assist the kindergarten class in their various projects. One of these was the nest building. We were provided with grass, feathers, wet mud and so one. What we didn’t have was know-how. One person held grass in a rough circle while another tried to daub on wet mud. What a mess we made! One thing we did learn was a profound respect for birds. How do they manage with only beaks, feet and wings? The birds obviously know what they are doing. Who told the birds how, what, where and when to build their nests? This is a very good question. Read the rest of this entry »
Human Genome: The Molecule is the Message
On Tuesday, June 27, 2000 the National Post published a two page spread. At first glance, it did not look that exciting. The text on these pages consisted only of four letters, C, G, A and T, arranged in seemingly random order. The final line, for example, begins
- CATGGTGTCATACTGCTCTTTATTTTATT… Read the rest of this entry »
Some Ice is Nice
It’s payback time for Radarsat, the radar imager satellite operated by the Canadian Space Agency. In exchange for the satellite’s launch by an American Delta II rocket on November 4, 1995, Canada agreed to provide NASA with access to a certain amount of data and to execute a realignment twice during the mission in order to allow for the mapping of the Antarctic continental ice sheet. Consequently in September 1997, Radarsat rotated its viewing apparatus 180 degrees and on September 14 the first radar images of the South Pole were taken. The resulting images proved to be quite stunning, better than the experts had dared to hope. And the information collected will be most welcome. Resolution of controversies over global warming and the fate of the Antarctic ice sheet, could have important impacts on government policy in the years to come. Read the rest of this entry »
Tales of Turtles: Zoology is a Great Career
As a teenager I was active in the Boy Scouts, and in lower levels of school I had an interest in science and math. I was a radioman in the US Navy during the Second World War, and in college I majored in zoology with very strong concentrations in Bible and chemistry. Read the rest of this entry »
That Fossil is a Fake!
Have you ever wished that you could rewrite an event in your life? It happens to all of us once in a while, of course. However the results are a little worse when something has been published. It’s harder to imagine that the event never happened. Thus it was in 1999 that some palaeontologists positioned themselves far out on a limb (metaphorically speaking), and in early 2000 somebody cut the branch off. Oooops…… Read the rest of this entry »
The DNA Disaster
Have you ever imagined yourself as a best selling author? Detective stories sell well. Let’s give it a try. My story is set in an imposing country home in England. The wealthy owner happens to wander into his wife’s dressing room. She is away on an expedition to the beach. The gentleman notices his wife’s diamond necklace carelessly flung onto the table amidst expensive perfume bottles. Horrified, he swoops down upon the jewelry, only to discover that this is a cheap imitation of the real necklace. Promptly he calls the local inspector who sends out four detectives. The detectives snoop around and each presents his theory on the case. Detective Smith declares that the butler stole the necklace and sold it in London. Detective Jones strongly suggests that his evidence implicates the maid. Detective Cooper accuses the daughter’s boyfriend of helping himself to the jewels. Detective Trent indicates that the evidence points to the son of the family who has wasted huge sums of money on fast cars. The gentleman is now thoroughly confused. When his wife returns home, he shares all these distressing details with her. It is then that his wife informs him that actually she lent the real necklace to her sister, Lady Hampton, who is scheduled to attend a royal court event that very evening. Read the rest of this entry »
Tourist Trek to the American Southwest
A well known nineteenth century musical comedy features the Mikado, a head of state who knew what he wanted. He wanted to execute people he did not like. Indeed he had a little list of these proposed victims. One of the most amusing solos in the musical is his refrain
- I’ve got a little list
I’ve got a little list
There will none of them be missed
There will none of them be missed! Read the rest of this entry »
What Big Eyes They Had!
A tiny news item caught my eye: “Creature liberated from oilsands” (Edmonton Journal November 4, 2000 G1). Apparently a rare marine fossil was found earlier this year near Fort McMurray. The oilsands are making quite a name for themselves as a source of fossils. Besides unfossilized remains of trees, excavators have turned up nine marine reptiles, mostly plesiosaurs, from the oilsands. One of the earlier specimens, like the recent find, was identified as an ichthyosaur. Read the rest of this entry »












